You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
relA [2020-05-13 09:57:07]
Molecular weight
84.65 kDa
Product
GTP pyrophosphokinase
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,820,529 → 2,822,733
Phenotypes of a mutant
requirement for valine PubMeda relA sasA sasB triple mutant requires branched chain amino acids, methionine and threonine for growth, the requirement can be suppressed by reduced expression of guaB or inactivation of codY PubMeda relA sasA sasB triple mutant acquires suppressor mutations in guaA, guaB, gmk or inactivation of codY PubMedmutation in relA results in increased motility and chaining via elevated SigD level PubMed The protein
Catalyzed reaction/ biological activity
ATP + GTP --> AMP + guanosine 3'-diphosphate 5'-triphosphate (according to UniProt)Protein family
RelA/SpoT family (with SasA and SasB, according to UniProt) Domains
N-terminal ppGpp hydrolase domain (HD domain) (aa 31-180) PubMedcentral ppGpp synthetase domain PubMedTGS domain (aa 392-453) (according to UniProt)C-terminal ACT domain (aa 660-734) (responsible for fine-tuning of activation at the ribosome) PubMed Effectors of protein activity
(p)ppGpp synthesis is activated by uncharged tRNAs in a ribosome-dependent mannerthe interaction with ComGA inhibits the hydrolysis of ppGpp PubMedheat stress triggers (p)ppGpp synthesis PubMedthe presence of immature tRNAs due to depletion of RNase P or RNase Z triggers (p)ppGpp synthesis by RelA PubMed Structure
5IQR (from E. coli, bound to the ribosome, 38.8% identity)1VJ7 (N-terminal catalytic fragment, from Streptococcus equisimilis, 60% identity) PubMed Expression and Regulation
Biological materials
Mutant
GP3429 relA-6xHis-cat, available in Jörg Stülke's labrelA mutant PubMed - note that relA mutants are prone to suppressor mutations in the sasA or sasB loci PubMedGP2066 (sasA sasB relA::mls), available in Jörg Stülke's labBKE27600 (ΔrelA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGABKK27600 (ΔrelA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA Labs working on this gene/protein
References
Reviews
Loading
Original publications
Loading